Sentence examples for by visualisation on a from inspiring English sources

RNA quality was assessed by visualisation on a denaturing formaldehyde RNA gel (protocol recommended by Qiagen) using ethidium bromide staining.

Following extraction, RNA was assessed for quality by visualisation on a 1.2% denaturing formaldehyde agarose gel, quantified using a Nanodrop spectrophotometer (Thermo scientific).

RNA quality was assessed for all samples by visualisation on a denaturing formaldehyde RNA gel (protocol recommended by Qiagen, Valencia, CA, USA) and ethidium bromide staining.

The purified RNA was quantified by spectrophotometric measurements and its purity and integrity verified by the OD260/OD280 ratio (> 1.8) and by visualisation on a denaturing gel.

Total RNA and mRNA was quantified by spectrophotometric measurements at 260 nm and 280 nm and its purity and integrity verified by the OD260/OD280 ratio (>1.8) and by visualisation on a denaturing gel.

The RNA was quantified by spectrophotometric measurements at 260 nm and 280 nm and its purity verified by the OD260/OD280 ratio (>1.8) and integrity validated by visualisation on an agarose gel.

Primers representing previously annotated (5' GTGAGGAGGTTTTCTTGGAAG 3') and novel (5' CTTCTAGGGAATTGCGACTG 3') exons were used with a common reverse primer (5' CTGGGAAATACATCAGCTGG 3') to amplify products by RT-PCR followed by visualisation on an agarose gel and sequencing.

In each case, total mRNA was purified and its integrity validated both by visualisation on ethidium bromide stained formaldehyde gels and via an Agilent RNA 6000 Nano chip using a 2100 Agilent bioanalyser (data not shown).

The concentrations of DNA extracted were determined using a QuBit fluorimeter (Invitrogen), and the DNA quality was evaluated by visualisation on agarose gels.

Genotyping of the Int7G24A variant was performed by PCR amplification of intron 7 using primers Fwd- 5′-GGAGGTTCATCCAAATATGGC-3′ and Rev- 5′-CTCTGGCACTCGGTGACAT-3′ followed by Bsr1 digestion and visualisation on a 2.5% agarose gel.

Microsatellite markers were genotyped using either of two methods: independent amplification and visualisation on a CePRO 9600 TM (Combisep, Ames, IA, USA) capillary analysis system, or by undertaking amplification and high resolution melting (HRM) analysis using a Roche Light-Cycler®.