Sentence examples for by using universal from inspiring English sources

Exact(31)

Static compression tests were made by using universal testing machine.

The study investigates soil erosion in the basin by using Universal Soil Loss Equation (USLE) and by mapping erosion fragility units.

The specimen is prepared according to ASTM standards and the experiment has been carried out by using universal testing machine (UTM).

Spanish courts have gained a reputation for activism in recent years by using universal jurisdiction to pursue cases against alleged human rights violators in several countries, most famously against the former Chilean dictator Augusto Pinochet.

Design Data collected on household food purchases accrued over a 13-week period were selected by using Universal Product Code numbers and household characteristics from a marketing research database.

The USML properties, such as sustainability, temperature dependence and input mechanical load dependence, were same as the ML properties shown in conventional ML test by using universal testing machine so far.

Show more...

Similar(29)

16S rDNA nucleotide sequences was amplified from chromosomal DNA by PCR using universal oligonucleotide primers and sequenced by BGI, China.

b distinct FITC colour of stained colonies Further, the 16S rRNA genes of the isolates were amplified by PCR using universal primers [ 7] and subsequently analysed by sequencing.

Segments from these genes can be easily amplified by PCR using universal primers and sequenced.

The 16S rRNA gene was amplified by PCR using universal primer: F: AGAGTTTGATCCTGGCTCAG, R ACGGCTACCTTGTTACGACTT (Weisburg et al. 1991).

The full lengths (~ 1500 bp) of 16S rRNA genes were obtained by PCR using universal bacterial primers (24F: AGAGTTTGATCCTGGCTCAG and 1492R: TACGGYTACCTTGTTACGACTT) (Farris and Olson 2007).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: