PCR was performed by using two primers each for boule (bolf, CGATGGAGAACGAAATAACCC; bolr, GAGAGCCAGGGCCCTGAGCGGGAGG), dazl (dazf, ATTTATTCTGTTTTAACGGTTTTAGAA; dazr, ACAGAGGTCATGGCTCAGCAGA) and vasa (vasf, GGGACCTCATGGCCTGTGCC; vasr, ATCACTCCCATTCGTCGTCG; accession number, AB032566.1).
As a control, β-actin was amplified from the same set of cDNA samples by using two primers TA1, TTCAACAGCCCTGCCATGTAC; TA2 (CCTCCAATCCAGACAGAGTATT) according to the trout actin cDNA sequence (accession number, AF157514.1).
The TMDQ evaluation was carried out by using two primers (tot mt S: CCATCTTTGCAGGCACACTCATC and tot mt A: ATCCACCTCAACTGCCTGCTATG) flanking a sequence of mt DNA known not to be susceptible to deletion [51] and an ad hoc designed FAM-labeled molecular beacon (mt tot: CGCGATCTCACGCAAGCAACCGCATCCATGATCGCG).
In the biomolecular analysis, the larvae were subjected at the DNA extraction and following PCR, by using two primers to amplify the genomic region of the ribosomal DNA, containing ITS1, 5.8S gene, and ITS2 [ 10].
By using two primers (OG155 and OG156) flanking an ltx promoter region, we obtained two different length PCR products: 696 bp for 652 and 195 bp for the JP2 genotype.
Mouse genotyping was done by polymerase chain reaction (PCR) of proteinase K-digested toe DNA as we have previously described by using two primers IFT20F (5′-ACT CAG TAT GCA GCC CAG GT-3′) and IFT20R (5′-GCT AGA TGC TGG CGT AAA G-3′), which yielded a 506 bp band for the flox allele and a 404 bp band for wild-type allele.
Therefore, nested-PCR amplifications of the pr1 B gene were performed by using two primer pairs.
Genomic PCR was performed by using two primer sets (set 1: forward primer, 5'-ATGGCTTCTAGCTATCCTTATG-3', and reverse primer, 5'-GTAGCAACCTGTGCAATTTCTTC-3'; set 2: forward primer, 5'-CTGCTAACCATGTTCATGCC-3' and reverse rimer, 5'-ACAAGTTTAGCTCCAATGTTTTTGTA-3').
Initially, amplifications were carried out by using two primer pairs of mtDNA and one for cpDNA (Table 2).
As reported before (Zhang et al. 2009), there were four AOA amoA OTUs (on the basis of the 5% nucleotide cutoff) recovered by using two primer sets in this sludge.
