Sentence examples for by using the reverse from inspiring English sources

The control data points of an impeller or a blade were obtained by using the reverse engineering method.

For by using the reverse H lder's inequality and the same way, we have the equivalent reverses of (3.6) and (3.7) with the same best constant factor.

Two fault models based on different available moment tensor solutions were employed, and their locations were constrained by using the reverse tsunami travel time from the stations to the epicenter.

For example, Au/polystyrene (PS) cable-like structures were obtained via emulsion polymerization on as-prepared Au nanorods [11]; Ag nanofibers/PS nanocomposites were prepared by using the reverse micelle-gas antisolvent-ultrasound method [12].

For 0 < p 1 < 1, p i < 0 ( i = 2, …, n ), by using the reverse Hölder inequality and in the same way, we have the equivalent reverses of (19) and (20) with the same best constant factor.

Based on the scanned point cloud data, the three-dimensional numerical models of the external auditory canal, tympanic membrane and middle ear are established by using the reverse prototyping technology, as are the FEM models.

Since red cells were not available, we determined ABO blood group for a subset of participants by using the reverse-typing test tube method with A1 and B Referencells (Immucor, Norcross, GA) as specified by the manufacturer.

Total RNA was then reverse-transcribed by using the Promega reverse transcription system (Promega, Southampton, UK, Cat # A3500).

RNA (250 ng) was reverse-transcribed by using the QuantiTect Reverse Transcription Kit (Qiagen) in accordance with the instructions of the manufacturer.

Two micrograms of total RNA from each specimen was reversed transcribed by using the Superscript reverse trascriptase (Life Technologies Milan, Italy) and random examers: PCR amplification was performed using Amplitaq polymerase (Applied Byosistem) according to BIOMED-1 (van-Dongen et al, 1999) protocols.

These oligos were annealed, filled in with Pfu and amplified by PCR using the reverse primer and a T7 promoter primer (AGTAATACGACTCACTATAG).