An i-trace represents a set of solutions which sort π k into π k + i )by using the same set of i reversals, respecting the overlap relationship among them.
The validity of the proposed method is demonstrated through experimental studies in which input signals exerted at piezoelectric (PZT) patches on a quasi-isotropic composite plate are successfully reconstructed by using the time reversal method.
In [31], the fault localization problem is analyzed in the power networks by using the electromagnetic time reversal technique.
(4) Furthermore, by using the VTRM (Virtual Time Reversal Mirror) technique, the ISI (Inter Symbol Interference) of the Chirp carrier can be decreased and the robustness can be increased.
The correlations between the kinetics of the thermal hysteresis, the distributions of sizes and intermolecular interactions and the transition temperature distributions were established by using the FORC (First Order Reversal Curves) method using a Monte Carlo technique within an Ising-like system.
In addition, DNA sequencing on PCR products was also carried out to further assess the DNA methylation status of SFRP1 promoter, where the CpG islands-enriched region within SFRP1 promoter was amplified with bisulfite-treated genomic DNA by using the primers (forward: TTTATGGGTTTGTAAGTATGATTTAGG; reversal: ACAAATTAAAC AACACCATCTTCTT).
To measure behavioral flexibility, we habitually trained mice and then analyzed their responses to a change in routine in a reversal task by using the Morris water maze test and the Barnes maze test, which have been generally validated for spatial learning and memory (Crawley, 2007; Miyakawa et al., 2001).
The search was conducted in November 2012 by using the exploded terms rivaroxaban, dabigatran, and apixaban and the textwords 'reverse' or 'reversal'reversal
Conductance (G) was calculated by dividing CLC-5 currents by V-Erev, using the predicted reversal potential, Erev, calculated from the equations in Accardi and Miller (6) and with a transport ratio of 2Cl−:1H+ in CLC-5 (5).
For each test and control sample, two hybridization processes were performed by using a reversal of the fluorescent dye strategy.
