Sentence examples for by using the housekeeping from inspiring English sources

Each sample was normalized by using the housekeeping gene Histone H3 with the following primers: H3 F: GGTGAAGAAACCTCATCGTTACAGGCCTGGTAC H3R: CTGCAAAGCAC CAATAGCTGCACTCTGGAAGC.

Loading differences were normalized by using the housekeeping control GAPDH.

The amount of DNA and cDNA were normalized by using the housekeeping (buffalo β actin gene).

Data were normalized by using the housekeeping gene B2M, after a selection procedure involving six different endogenous reference genes, as suggested in the MIQE guidelines [ 26].

Each sample was normalized by using the housekeeping gene Histone H3 with the following primers: H3 F: 5′-GGTGAAGAAACCTCATCGTTACAGGCCTGGTAC-3′ H3 R: 5′-CTGCAAAGCACCAATAGCTGCACTCTGGAAGC-3′.

Sensitivity of the nested L-PCR was determined by using the housekeeping gene GAPDH, which occurs in humans as 1 copy/cell (13 ).

Semi-quantitative analyses were conducted to detect Fas, DR5, Bax, Noxa and Bcl-2 mRNA by RT-PCR using the housekeeping gene β-actin as control.

The obtained data were normalized by using the internal housekeeping gene, GAPDH.

The expression of ADAM33 in breast tumour cells was analysed by RT-PCR using the housekeeping gene GAPDH as an internal control.

To validate the microarray results, qRT-PCR analysis was performed on three down-regulated (p53, HSPE1 and HIST1H3C) and three up-regulated genes (IL1B, CREBBP and LYN) as evidenced by microarray experiments, using the housekeeping gene GAPDH as internal control to normalize the relative expressions of target genes.

Relative expression levels were determined by the ∆∆Ct method using the housekeeping genes GAPDH and U6 for normalization (Zhu et al., 2013).