Sentence examples for by using some outside from inspiring English sources

This is accomplished by using some outside money and lots of unpaid student labor and by inventively recycling salvaged materials.

The ANC9s work the way most noise-canceling headphones do, by using microphones outside of the headphones to hear the noise around you, then playing a sound that cancels out the noise.

(Thought you were keeping your ideas safe by using an outside email program like Gmail or Yahoo Mail on your work computer? Sorry, no).

The decade-long partnership turned sour early in 2007, when Danone publicly accused Hangzhou Wahaha of illegally selling Wahaha-branded products by using distributors outside of the ones selected by their joint ventures.

In brief, a RT-PCR mixture was prepared by using the outside primer set (P1401 – ACCAACTACTGTGGAGTC and P1845 – TTCCATCTTCACTCTACACT) to amplify a 445-bp product.

When driving to the basket, a player's chance of making a lay-up is increased by using the outside hand to lay-up.

One way the office stretches its resources is by using outside monitors.

By using outside partners, Facebook itself would not license any content from record companies or television networks.

Smith's program combined tutoring with athletics and was used by schools trying to raise their performance by using outside educational services.

Ms Dennis, unsurprisingly, claims in a newspaper article that one can have a long and fruitful career in pop by using outside songwriters.

It was unclear why the authorities would risk jailbreaks by using prisoners for outside labor.