Sentence examples for by using primers modified from inspiring English sources

Nested PCR amplification was performed by using primers modified from those described elsewhere (11).

09N1-I149V mutant was generated by using primer F: 5′-CATTCCAATGGAACCGTTAAAGACAGGAGC-3′ and primer R: 5′-GCTCCTGTCTTTAACGGTTCCATTGGAATG-3′.

Human PRDM5 CDS was amplified by PCR using specific primers modified at the 5' end with the sequence recognized by BamH1 restriction enzyme (B-PR5f1: 5'- GC GGATCCCTGGGCATGTACGTGCCGGA-3'- GC GGATCCCTGGGCATGTACGTGCCGGA-3AGCTACACCAT-3'- GC GGATCCCTGGGCATGTACGTGCCGGA-3of the pCDNA3-HA vector (Invitrogen).

cDNA was synthesized using random primers, modified and enriched for attachment to the Illumina flowcell.

rQ-M38G was constructed as follows: The UL38 promotor was isolated from HSV rRp450 by PCR using primers designed previously [18] that were modified to include a 5' BglII and 3' HindIII sites (F1, R1 in Table S1) and cloned into the BglII and HindIII sites of pCMV-GLuc (Invitrogen), replacing the CMV promoter.

For each taxon a total of 5248 base pairs (bp) of mitochondrial DNA (mtDNA) was either sequenced directly using primers reported by or modified from [ 89] or downloaded from GenBank.

BAG3 (NM_004281.3) 3′-UTR, 504-bp long, encompassing the predicted miRNA targeting sequence, was amplified by PCR by using the modified primer pair FW5′-TCATGTATAGAGCT|CCTCTGCCCTGTAAAAATCAGA-3′(SacI) and RW5′-TCATGTATAA|AGCTTAAAATGTAGCATTAAAGTCATCCAA-3′(HindIII), and gDNA template isolated from a patient carrying the SNP rs8946 in homozygosis or from a donor carrying the wt sequence.

The CRISPR target site was modified by single-step mutagenesis using primers 1119 and 1120.

The method was modified by including an internal control, using primers targeting the 16S rDNA genes, in a multiplex PCR assay (Edwards et al. 1989).

YopP-kanamycin, flanked by 36-nt of homology to the open reading frame of YopJ, was PCR amplified from the modified pGEM-T Easy Vector using primers YopP/J-kanRF and YopP/J-kanRR (Table 1).

A modified version of the aprE promoter (PaprE) (developed and tested in [72]) was amplified by PCR from pSG-TTGACA [72] using primers PaprESG-D/AgeI (tgaaccggttgtcaaacatgagaattcagcg) and PaprE-R/FseI (caaggccggccaaattcagagtagacttacttaaaagac).