Sentence examples for by using primers for from inspiring English sources

Exact(24)

To assess the expression of individual genes, a cDNA was generated and amplified by using primers for mouse Cdc42 (5'GCCTandACTCCAGAGACTGC3'), and (5'GTTCATAGCAGCACACACCTG3'), RhoA (5'GTTGGTGandGAGCTTGTGG3'), and (5'GCAGGCGGTCATAATCTTCC3'), Rac1 (5'andCCATCAAGTGTGTGGTG3'), and (5'CTTGTCCandTGTGTCCCAT3'), and β2-microglobulin (5'GGCCTGTandCTATCCAGAAA3') and (5'GGCGTATGTATCAGTCTCAGTGG3').

PCR products were purified, and both strands were sequenced by using primers for PCR amplification (19 ).

We confirmed this by using primers for gltA and ompA specific for R. conorii.

cPolymerase chain reaction for scrub typhus positive (by using primers for 56-kDa antigen gene).

Real time PCR was used to assess the enrichment over background by using primers for KERV LTR.

Capsular type was confirmed by capsule-specific PCR by using primers for types Hia Hif (23 ) and slide agglutination (20 ).

Show more...

Similar(36)

An additional test for gDNA contamination was performed by using primers specific for the gene hdac1 (histone deacetylase 1; PF3D7_0925700).

Results obtained by using primers specific for ORF1 and ORF2/3 of the HEV genome were in agreement, except for material from 1 patient.

Extracted nucleic acids were then subjected to real-time PCR by using primers specific for HBoV.

Initial screening was performed by using primers specific for the S segment as described (20 ).

Shigella/EIEC was identified by using primers specific for the ipaH gene (7 ).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: