Sentence examples for by using primer pair from inspiring English sources

The DNA samples extracted from whole blood (100 ng) and hair (2 µL of lysate) were amplified by using primer pair L15990/H650 and the same conditions as the second PCR for single cells.

The second PCR product was obtained by using primer pair ATGGCTTCTATGACTGGTGGT and GGAATTCCCAACCATGTGGTCTGACACCAAACATAATGG, and used plasmid pDJ437 as a template.

The first PCR product was obtained by using primer pair, ATTCCAGATATGCGTTATAACCT and ACCACCAGTCATAGAAGCCATTTTTGATTCTTGGATATGGTT, and used plasmid pDJ135 as a template.

yehV, a known integration site of stx1, was screened in silico by using primer pair A/B from (29 ).

The 583-bp PCR product obtained from the coinfected dog by using primer pair 555for/555rev was digested with MboII.

Partial bacterial 16S rRNA genes of the community DNA were amplified by using primer pair GC-BacV3f [ 50] and 907r [ 51] as described by Koskinen et al. [ 26].

Then duplex RT-PCR protocol for simultaneous detection of ACLSV and ApMV was standardized by using primer pairs ACLSV-CP1F & ACLSV-CP1R and ApMV-CP1F & ApMV-CP5R, respectively, along with primer set for internal control.

c-Kit coding sequences were amplified from complementary DNA with the PCR by using primer pairs indicated in table 1.

In brief, this was accomplished by using primer pairs covering overlapping DNA sequence fragments across the complete mitochondrial genome.

In this study we have characterized antibiotic resistance gene cassette arrays in class 1 integrons that could not be amplified using standard PCR primers, by using primer pairs that target the intI1 gene and IS26.

Partial internal gene segment sequencing was initially performed by using primer pairs (5 ).