Your English writing platform
Discover LudwigExact(1)
Experimental results show that in addition to improving the predictability, a reduction of 21% in mean delay per task and a reduction of 18% in total power consumption are achieved for MPEG4 (and H.264/AVC) by using MT and locking 25% of the L2.
Similar(59)
This paper considers the problem of robust decentralized adaptive output feedback stabilization for a class of interconnected systems with dynamic input and output interactions and nonlinear interactions by using MT-filters and the backstepping design method.
The "common heritage" hypothesized herein for the Ascaridida and Strongylida to the exclusion of the Spirurida has been supported by previous studies using mt gene order data [ 49] and using concatenated amino acid sequence data inferred from protein-coding mt genes [ 38].
Mt rps13 ESTs from Malus (CN871057 and CN875489) and Prunus persica (AJ873687) were identified by BLAST searches of GenBank using mt rps13 from Beta vulgaris as a query.
There are also difficulties in measuring very low levels of blood MT protein by the commonly used MT assays.
In order to validate sequencing by this approach, we used mt data for H. contortus mined from public databases as a scaffold for mapping and assembly.
There is no direct access from northbound US 15 to westbound US 340 or from eastbound US 340 to southbound US 15; that access is provided by using the Mt. Zion Road interchange to get turned around.
The entire secondary structures of the LSU rRNAs for both pseudoscorpions were inferred by comparisons with conserved regions in Archaea, Bacteria, and Eucarya [ 40] and by using the mt LSU rRNA structure from the harvestman Phalangium opilio [ 14].
By using the mT-RFLP analysis, we have isolated the rhamnolipid-producing oil-eating Pseudomonas sp. ZS1 strains from the mixed culture of petroleum sludge-originating microbes cultivated in MS medium supplemented with 2% glucose (Cheng et al. 2017).
Here we address this deficit by using complete mitochondrial (mt) genome sequences to elucidate the broad genetic diversity and population structure of P. vivax from temperate regions in East and Southeast Asia.
The TMDQ evaluation was carried out by using two primers (tot mt S: CCATCTTTGCAGGCACACTCATC and tot mt A: ATCCACCTCAACTGCCTGCTATG) flanking a sequence of mt DNA known not to be susceptible to deletion [51] and an ad hoc designed FAM-labeled molecular beacon (mt tot: CGCGATCTCACGCAAGCAACCGCATCCATGATCGCG).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com