Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
Table 1 indicates the CoV genera identified by using individual primer sets.
Similar(59)
The first-strand cDNA was further amplified by PCR using individual primer pairs for specific genes (Table SIII).
PCR reactions were performed using individual forward primer and the P3 reverse primer.
Changes in individual genes were confirmed using individual PCR primer sets (SABiosciences; Table 1).
The expression levels of miRNA were quantified by real-time PCR using individual miRNA-specific primers (part of TaqMan miRNA assay kit; Applied Biosystems) with 7900HT Fast Real-Time PCR System Applied Biosystemss) according to the manufacturer's instructions.
> An initial screening was performed using two individuals from each area by using 64 primer combinations for selective amplifications.
Genotypes of each individual were confirmed by PCR by using the primer specific for Tau deletion region using primers 5'GGAAGACGTTCTCACTGATCTG, and 3'AAGAGTCTGGCTTCAGTCTCTC and subsequent capillary based sequence analysis [ 49, 50].
09N1-I149V mutant was generated by using primer F: 5′-CATTCCAATGGAACCGTTAAAGACAGGAGC-3′ and primer R: 5′-GCTCCTGTCTTTAACGGTTCCATTGGAATG-3′.
The presence of the T-DNA in segregating individuals was detected by using oligonucleotide primers (Table S6) specific to the neomycin phosphotransferase II (NPTII) gene present within the T-DNA.
> The RAPD analysis yielded a total of 232 loci for 130 individuals generated by using 20 selected primers, of which 78.9 % (183 fragments) were polymorphic between individuals [see Supporting Information— Table S4 ].
The upstream region was further amplified by using ACL and ALA primers.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com