Sentence examples for by using forward and from inspiring English sources
That is, the speed of proposed algorithm is reformulated by using forward and backward steps, and it further smooth the location state; it results in larger estimation errors around the corners.
All filtering was applied by using forward and backwards filtering to obtain zero phase shifts.
BAC assemblies were then manually examined for misassemblies and if they were found, the data was sorted as best as possible by using forward and reverse pair data.
The PCR products were purified using QIAquick PCR purification kit (Qiagen Milan, Italy) and sense and antisense sequences were obtained by using forward and reverse primers respectively.
Sequence determination of the amplicons was performed by using forward and reverse primers of respective PCRs on an ABI PRISM 377 Genetic Analyzer (Applied Biosystems, Waltham, MA, USA).
PCR products were purified by QIAquick PCR purification kit (Qiagen) and sense and antisense sequences were obtained by using forward and reverse internal primers, respectively.
By using forward reasoning and knowledge rules, the system can automatically change and regenerate the national defense budget plan immediately.
The company protects itself against short-term volatility by using forward contracts and by buying directly from farmers with whom the firm has a long-term relationship.For retailers food inflation is "moderately good", says Christopher Hogbin at Bernstein Research.
The statistical method Multiple Linear Regression (MLR) implemented in the STATISTICA software was employed in order to select the MDs included in the model by using Forward Stepwise and Backward Stepwise selection procedures.
The 393-bp genomic fragment was generated by using forward (SLE727 – GTAGCCGACGGTCAATCTCTGTGC) and reverse (SLE119c - ACTCGGTAGCCTCCATCTTCATCA) primers and using parameters as for WNV (9 ).
Briefly, point mutations were obtained by PCR using forward and reverse overlapping mutagenic primers (Figure S3 and Table S2).
