Sentence examples for by using an outside from inspiring English sources

(Thought you were keeping your ideas safe by using an outside email program like Gmail or Yahoo Mail on your work computer? Sorry, no).

To examine the functionality of the mutant Mks1 protein, we generated an antibody to Mks1 by using an epitope outside of the deleted domain, a region that is completely conserved between mouse and human MKS1 (see Methods).

First by using a trocar from outside and with coblation (radiofrequency) from inside.

Additional samples were trapped during the entire night by using a double net system: an outside untreated net with holes and an inside intact net with a sleeping person.

In addition to the utilization of a general truncated octahedron as the MD simulation box, central to the proposed extension is an image approximation method to compute the reaction field for a point charge placed inside such a non-spherical cavity by using a single image charge located outside the cavity.

Briefly, the mice were trained to find a submerged platform by using a stationary array of cues outside the pool tub.

He then alluded to an article in The Daily News in which Mr. Moerdler was accused of parking illegally outside the Cornell Club by using a police-issued placard.

The page you may want to hide may still be found by using different search terms, by using a newspaper's own search facility, or by using a search engine based outside the EU — which may include google.com itself.

Note that { p ijkl (sa, p, x, x ′)} i < j, k < l can be computed by using a variant of the inside outside algorithm of the Sankoff model (Sankoff, 1985), whose time complexity is O(| x|| x′|).

In brief, a RT-PCR mixture was prepared by using the outside primer set (P1401 – ACCAACTACTGTGGAGTC and P1845 – TTCCATCTTCACTCTACACT) to amplify a 445-bp product.

When driving to the basket, a player's chance of making a lay-up is increased by using the outside hand to lay-up.