Sentence examples for by using a left from inspiring English sources

Exact(2)

We calculated hazard ratios for all cause mortality by using a left truncated Cox proportional hazards model, entering participants at the age of first participation in the Olympic Games.

A 6.8 kb fragment upstream from the fMyHCx ATG was isolated by PCR from bacterial artificial chromosome zCR392328 by using a left primer containing an AscI restriction site (TGGCGCGCCTGCATGGTGTTTGACA) and a right primer containing NcoI (ACCCATGGTGGCGGCTTACCGT).

Similar(58)

The presence of a T-DNA insertion in PANS1 was determined by PCR using a left-border outwardly directed primer (SALK_LB1.3) in combination with a gene-specific primer flanking the site of insertion.

First, we instructed subjects to shift 60% of their body weight to the left side by using a vibratory cue on the left side waist (i.e., L1/2; Fig. 2).

You navigate by using a menu on the left side of the screen.

First Prince William was removed from the photo and then Kate's right arm was reattached by using a mirror image of her left, to give the impression she was posing on her own.

In the process of removing her husband, the Duke of Cambridge, from the original photo and digitally reinstating Kate Middleton's right arm – by using a mirror image of her left arm – to give the impression she was posing on her own, her waist was also reduced in size.

TBI was induced at the left cortex by using a TBI 0310 Impactor with a 5 mm impactor tip at a velocity of 5 m/s and a depth of 2 mm for 500 ms dwell time) (Precision Systems and Instrumentation, LLC, Fairfax, VA, USA).

On the 1st, 4th, and 7th day of the experiment, the twenty-four rabbits of experimental groups were administered an injection of 0.5 ml of 1.6%% papain solution into the joint cavity of the left knee by using a 16-gauge hypodermic needle, and a control injection of the same amount of solution without papain in the right knee.

Visually, and by using a handheld nail finder, check for left-over nails and other metal that has been left in the wood.

We detected the binding of CD58-BV to the wells coated with CD2-BV by using a CD58-specific antibody (Fig. 2B left panel).

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: