Amplification of the variants located upstream of the coding sequence was performed by single colour detection for the H/L polymorphism and multiplexing by dual colour probes was used for simultaneous genotyping of X/Y and P/Q.
After extensive washing, the cells were analysed by single-colour FACS analysis.
The probes are detected by single-colour chemiluminescence with high sensitivity [ 4].
The remaining undamaged leaf area was measured with WinRhizoPro (Regent Instruments Inc., Ottawa, Canada) by automatic colour analysis measurements.
Single colour labelling, hybridisations and image analysis were performed at the Ramaciotti Centre for Gene Function Analysis (University of New South Wales, Australia).
Analysis was performed using single colour flow cytometry on a FACScan (BD, Oxford, UK).
These candidates were selected by a combination of double component fitting, morphological assessment, and colour analysis.
Scanning the content of nearly 44,000 photos from 166 participants, the program predicted clinical depression diagnoses by parsing facial detection data, platform activity metrics, metadata, and colour analysis.
Semi-quantitative PCR analysis o the C/EBPδ mRNA were performed with specific primers (AGTTCTTGGGACATAGGAGCGCA; GTACCTTAGCTGCATCAACAGGAG). qRT-PCR analysis was used to validate the profiling arrays, with a Biorad MyIQ single colour thermal cycler and a SYBR Green PCR Master mix.
Overlapping signals from different fluorophores were separated by comparing composite signals to a reference spectral library generated with single colour stained samples.
