Your English writing platform
Discover LudwigSuggestions(5)
Exact(3)
Routine control experiments for checking specificity of the primary and secondary antibodies were performed by replacing the specific antibody with normal IgG or PBS.
Negative controls were performed by replacing the specific primary antibody with normal mouse serum or PBS.
Also, it seems that the same qualitative behavior of the model might be obtained by replacing the specific formula listed on p. 8, with a more general monotonous relationship.
Similar(57)
The detection of non-154att CPVs was made by replacing the 154att specific primer in PCR 1 with a conserved forward primer.
Finally, we point out that MRB can easily be customized by replacing the mouse-specific categories, so allowing it to be used by any bio-community as an advanced content management tool for resources.
It is also possible to incorporate other sample-specific data when available by replacing the mass-spectrometry specific term o i (Equation 1) by a probability conditioned on other data sources e.g. LC separation profiles.
Once the cells reached the required confluency, two sets of triplicate wells were induced to differentiate by replacing the culture medium with the specific differentiation medium.
Allele-specific pyrosequencing was carried out by replacing the above biotinylated primer with allele-specific biotinylated primers, 5'CCCAAAATAATATCTATAAAAAAAAAATTCAC3', or 5'CCCAAAATAATATCTATAAAAAAAAAATTCAT3' which recognized the G or A allele of the rs3741210 polymorphism on the reverse strand after bisulphite conversion.
Antibody specificity was confirmed by replacing the primary antibody with a non-specific myeloma protein of the same isotype or non-immune serum.
Therefore, the proposed method could adjust an institution's specific situation by replacing the RTP database.
The instrument is readily adapted to specific disciplines by replacing the word "science" in each item with the name of the discipline of interest, as noted by Glynn and cols.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com