Sentence examples for by replacing the reverse from inspiring English sources

Negative controls were made by replacing the reverse transcriptase with diethyl pyrocarbonate-treated water.

This paper presents a new kind of aerodynamic shape for reentry capsule, called spherical cap cubic curve segment SCCS) shape, which is modeled by replacing the reversing cone segment of the traditional spherical cap segment-reversing cone SCSC) shape with a more various cubic curve segment, however the spherical cap section is retained.

Mutated vector was generated in Invitrogen by replacing the predicted target region with its reverse sequence (from ACUGCC to TGACGG).

Mutant vector was generated in Invitrogen by replacing the predicted target region with its reverse sequence (from AAGCACCAATAGCCTTGTTGGTC to CTGGTTGTTCCGATAACCACGAA).

Possible future prostheses in the treatment of RA include pyrocarbon prostheses, stemless prostheses (total and hemi), and prosthesis designs that are easily converted from conventional anatomic prostheses to a reverse design by replacing the modular component.

You can reverse this by replacing the code with "attrib -h".

Importantly, our data demonstrate it is possible to reverse the adverse effects of FUS depletion by replacing the FUS protein or by small-molecule intervention.

A variation of this synthetic path could proceed by replacing the counterion of the surfactant, and only then the addition of a salt to this reverse microemulsion media.

The method for replacing the portafilter is essentially the reverse of removing it.

And treating it is easy and safe: replacing the missing vitamins usually reverses all the symptoms.

If ISS has high specificity in retrieving active compounds, the reverse version of ISS by replacing active references in the neighbor list with inactive references should also retain the ability to identify inactive compounds.