Sentence examples for by replacing the position from inspiring English sources

Exact(2)

In August, Dynegy overhauled its management structure by replacing the position of CFO with three executives, including Hugh Tarpley Hugh Tarpley, who headed the newly created corporate development department.

Dynegy, an energy trader under investigation for questionable power deals, on Tuesday said it overhauled its management structure by replacing the position of chief financial officer with three executives.

Similar(58)

In addition to replacing the position made vacant by Muhr, the appointment of Kilgarriff could point to two other things.

Here, a mutein, tamavidin 2-REV, was engineered from tamavidin 2 by replacing the serine at position 36 (S36) with alanine.

For this study, we mutated the conserved lipidation motif of ospA by replacing the cystein at position 17 with aspartic acid to generate a protein that lacks the post-translational lipid attachment (Fig.1A).

Seq1 (5′-ACUAGCCUC A UCAGCUCAUGUGCCCCUCCGCC U GGAUCAC-3′) is mutated by replacing the nucleotide "A" at position 10 with "U" and changing "U" at position 33 to "A".

A control field for quantum wave packet dynamics is obtained by replacing the classical ensemble-averaged position and momentum with quantum mechanically averaged ones.

In contrast, expression of a constitutively active form of Gpa2 (pG2constructedonstructed by replacing the arginine residue at position 273 with an alanine residue [ 31] did not alter high pH tolerance.

The new scheme, which readily leads to a handful of new analogues of H3H by varying substituents R1, R2, and R3, enabled us to address the problems of water solubility and chemical instability of H3H by introducing hydrophilic groups and replacing the position-3 proton of the indole ring with a fluorine atom [24], respectively.

The peroxyl/hydroperoxyl group has also been proposed to bind at the axial position by replacing the solvent ligand.

The specificity of peptides corresponding to B3, A12, and G9 was greatly improved by replacing the glycine at the 2e position with a threonine, generating the MS1, MS2, and MS3 variants (for Mcl-1 specific), corresponding to the sequences of A12, B3, and G9 with a G2eT mutation, respectively.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: