Recombinant CaRF binds the camCaRE as evidenced by retardation of the radiolabeled camCaRE probe by EMSA (Figure 5b).
A second group of technologies has been developed to quantify the global 5-methylcytosine via the radiolabelling of CpG sites, ELISA method, pyrosequencing, use of methyl-sensitive enzymes in COBRA method for example [ 10, 11].
Materials and methods: SPIONs coated with biocompatible DPD-phosphonate were radiolabeled with positron-emitting Gallium-68 to quantify the accumulation of the nanoparticles in vivo.
Radiolabeled taxanes have also been used to quantify the modulation of Pgp, a new strategy in enhancing cancer chemotherapy, in nonhuman primates [ 60].
Ligand binding assays quantify the amount of ERs with unoccupied ligand binding domains (those that have not bound estrogen or a closely related molecule) by measuring the amount of radiolabeled specific binding of estradiol in tissue homogenates [ 6].
The dsattC containing donor substrate (120 bp) was obtained by annealing the 5'32P radiolabeled oligonucleotide AttC2 (5'-CGCCCGTCTAACAATTCGTTCAAGCCGACGTTGCTTCGTGGCGGCGCTTGCGTGCTACGCTAAGCTTCGCACGCCGCTTGCCACTGCGCACCGCGGCTTAACTCAGGCGTTAGATGCACT-3') with the complementary 5'32P radiolabeled oligonucleotide AttC2'.
The ds attI1 containing donor substrate (100 bp) was generated by annealing the 5'32P radiolabeled oligonucleotide AttI1 (5'-ACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAATGAGCATCATTGC-3') with the complementary 5'32P radiolabeled oligonucleotide AttI1'.
To separate and quantify the isomers of PtdInsP (PtdIns3 P, PtdIns4 P and PtdIns5 P), the classical method used requires equilibrium [H]inositol or [P]Pi radiolabelling of cells, lipid extraction and deacylation, followed by separation and analysis by ion-exchange HPLC [ 28].
Complexes of RRL-reconstituted TERT synthesized with S-methionine were F-purified and labeled with biotin, biotinylated TERT was depleted using streptavidin agarose, and the fraction of unbound TERT was quantified by radiolabel detection after SDS-PAGE.
Duration of clinical trial can be reduced by coupling the radiolabel substance or fluorescent dye to DDS.
