Sentence examples for by pairing a forward from inspiring English sources

This was achieved by pairing a forward primer specific to the upstream promoter (UPF: CCTGGGCTTTCAAGAGAACCACATG) with an L-specific exon 2 reverse primer (LE2R; CCCAGCACGAAGTAGCCAG) and in a separate reaction, pairing LE2R with a forward primer upstream of OPN1LW and OPN1MW (LM1F; GGTGGGAGGAGGAGGTCTAA).

Primer pair A: forward: 5′-TACAGGAGCGGAAGAAGTGG-3′; reverse: 5′-ACAGGAACAATGGGTTGGG-3′; primer pair B: forward: 5′-TCTCATCAATAGCAACTTGCTC-3′; reverse: 5′- TCACACTCACTTCCCTCTTAC-3′; and primer pair C: forward: 5′-TCCAGAGAGCAGGCTGAACAA-3′, reverse: 5′-AAGCCGGATGTAATCCTGTG-3′.

Hs578T cell line: Four sets of uniplex PCR reactions were performed by pairing 2 single forward (FA1 and FA2) and 2 single reverse (RX3 and RX4) primers.

Initialize a pairing with pairing parameters p. Free the space occupied by pairing.

Then the pair ( A, C ) is said to be (forward) estimatable (see [1]).

a Linkage group pairs separated with a forward slash '/' are known homeologous pairs while those divided by a dash '-' are possible paralogs or homeologs.

The sequences were assembled into contigs (continuous blocks of uninterrupted sequence) and supercontigs (contigs linked by paired forward reverse reads from the same plasmid) using the Phred and PCAP software packages.

For example, primer pairs may share a forward or reverse primer, or they may significantly overlap.

A forward pairing of Long and Peter Odemwingie will have West Brom fans salivating.

If sucrose stimulation is preceded one or a few times by an odor (forward pairing), the bee will form a memory for this association, and subsequent presentations of the odor alone are sufficient to elicit the PER.

Steering was controlled by a pair of hydroplanes forward and another pair aft, and a single rudder.