Sentence examples for by normalisation to the from inspiring English sources

Differences in starting material were compensated by normalisation to the endogenous reference gene GAPDH (forward primer: GTATTGGGCGCCTGGTCACC, reverse primer: CGCTCCTGGAAGATGGTGATGG).

Osteopontin mRNA levels were corrected for differences in loading/transfer by normalisation to the 28S ribosomal RNA (Materials and Methods).

The relative gene expression level was calculated by normalisation to the housekeeping gene ACTB using MxPro software (Stratagene, Santa Clara, CA, USA).

The average Ct value for each gene for each patient was calculated from the triplicates, followed by normalisation to the average of the two housekeeping genes following the 2ΔΔCt method (Livak and Schmittgen, 2001; Schefe et al, 2006; Yuan et al, 2008).

Each dataset was realigned to correct for any motion during the acquisition, time corrected due to differences in image acquisition time between slices, followed by normalisation to transform the data to match the SPM template.

The relative gene expression levels in each cDNA sample were obtained by normalisation to ACTIN1 using the formula 2- CT gene - CT actin1) [ 42- CT

Expression levels were calculated by normalisation to a standard curve using the total amount of RNA as a denominator and expressed as arbitrary units.

Consequently, we used two different sets of normalisation factors, 'NF jointly' and 'NF separately', compared the results with those obtained by normalisation to RNA input.

First, the 2−ΔΔCT method (Bio-Rad, 2006) was used followed by normalisation to PBGD and Ln (natural log) transformation.

The relative CCNL1 gene expression level was calculated by successive normalisation to the RPLP0 (Ribosomal phospho-protein P0) internal control and then to the mean expression of all the normal tissue samples.

However, this relies on an absolute quantification of TRECs by normalisation to a standard curve using cloned template.