Sentence examples for by modification of primers from inspiring English sources

Exact(1)

Primers for H. bilis, H. hepaticus, and Helicobacter universal primers were designed by modification of primers which were previously reported from Goto et al. [ 18] (Table 1).

Similar(59)

SM636 was engineered by modification of plasmid SM353 with primers 5055/5056 and 5057/5058 by site-directed mutagenesis as in Scott et al. (2006).

However, the method is readily tuned by modification of reaction conditions such as DNA concentration and primer annealing temperature.

For ITS2 sequence determination, the sequencing primers were 5.8SbF and 5.8SbR [ 47], 1800 F [ 43] and ITS4Xan (5'-TCCTCCGCTTAGTTATATGC-3'), which was a modification of primer ITS4 [ 48].

The amplified products of approximately 1,686 bp (1,656 bp for nested PCR) were sequenced by using a modification of 16 primers as described (Table 2) (11).

Modification of the primer 530F included two bases (TA) added to 3'-end in order to increase primer specificity.

The ASXL1 exon 12 until the stop codon was amplified by three pairs of primers and sequenced by another six internal primers, as described by Gelsi-Boyer et al., with mild modification.

DNA-handles were labeled with digoxygenine or biotine at their termini via 5′-end modifications of the primers carried out by Metabion or MWG (Fig.  4a).

Quantitation of miRNAs was done by a modification of the stem-loop reverse transcription method described by Chen et al.; primers used are listed in Table S2.

We genotyped the SHMT1 1420C→T polymorphism (rs1979277) by a modification of a Taqman assay (http://snp500cancer.nci.nih.gov; SNP500 assay number 003_1859), using amplification primers ATTTGTGAAGAAAACATGAA AAA (forward) and AGACTGGCAGGG GATAAGTA (reverse).

To decrease the number of multiplex PCR tubes, manual modification of some PCR primers and extension probes was conducted.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: