Sentence examples for by making insensitive from inspiring English sources

Exact(1)

Never offend by making insensitive jokes.

Similar(58)

I give you these three examples to caution you against making insensitive comments.

Rescue constructs were made insensitive to siRNA by replacing seven nucleotides while retaining coding identity (GACCTCATGGACTGTGGAAAT to GATTTAATGGATTGCGGTAAC).

They may not understand the depth of trauma incurred by the loss, and they may make insensitive comments.

Developmental psychobiologists reject a basic idea at the heart of much discussion of innateness, which is that evolution makes development reliable by making it insensitive to environmental parameters.

Yet one thing that economists on both sides seem to agree on is that the current system of employer-provided insurance promotes excessive demand by making consumers insensitive to the cost of care.

However, too large a diffusion coefficient prevents receptor relocalization (Fig. 4C) by making them insensitive to the effective potential created by the MTs.

Her female friends will make insensitive remarks at her expense.

"Justice Camp agrees that he made insensitive and inappropriate comments during the... trial," the notice states.

Future studies could investigate the role of Munc18-1 depresynapticsynaplasticityicity for information processing in neuronal networks, by making use of the PKC-insensitive mutation in transgenic mouse approaches.

Capsaicin activation of TRPV1 was first investigated by making chimeras between capsaicin sensitive and insensitive orthologs.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: