Sentence examples for by introducing the sequence from inspiring English sources
These are generalized then by introducing the sequence of symmetric subresultants of two polynomials.
It was further generalized by Et and Colak [11] by introducing the sequence spaces ℓ∞(Δ s ), c(Δ s ), c0(Δ s ).
Thus future work can focus on improving feature extracting methods by introducing the sequence features which consider the sequence-order information, such as K-space encoding scheme [ 19].
DNemulator allows also simulating the genotypes of a diploid genome by introducing the sequence variation from a set of confirmed SNPs (dbSNP135).
Flag-tag rhTRAILWT and flag-tag rhTRAIL 4C9 were constructed by introducing the sequence encoding a flag-tag N-terminally of the rhTRAIL (aa 114 281) sequence in pET15b.
The AAV vector with a modified RIP promoter, pAAV-mRIP Luc, was generated by introducing the sequence containing CMV enhancers, which was amplified by PCR with primers Forward Mlu1 5′-GCTC ACGCGTGTTGACATTGATTATTGACTAGTTATTAAT-3′ and Reverse Mlu1 5′-GCTC ACGCGTTAGACCTAGGGTAAAGATTATTAACAAGGGGCCAGATGGCCTGATGAAGCCCACCGTACACGCCTACCGCCCAT-3′ inthethe MluI site of pAAV-RIP Luc.
Present work provides an approach to overcome these problems by introducing the sequences of genes for different proteins in a single open reading frame via short linkers; subsequently, the linker sequences are cleaved into constituent protein units by host cell proteinase while passing through the plant endomembrane system (Francois et al. 2002).
The linker A-mCherry plasmid has been made by introducing the mCherry sequence from pmCherry-C1 vector (Clontech) into the EcoRI restriction site of pGEX-KG, following SNAP25 sequence (22 206 aa; four cysteines mutated to alanines).
By introducing the stacking sequence hypothesis of metal material, the mechanical properties parameters and plies' numbers of the metal material or composite material are defined as design variables; the mathematical formulation about material selection optimization approach is established.
By introducing the geometric sequence division (GSD) method, the discrete delay interval can be separated into multiple subintervals with unequal lengths based on the common ratio α.
In this paper, by introducing the geometric sequence division and integral delay partitioning approaches, stability problems of the perturbed T-S fuzzy systems with mixed delays are investigated.
