Sentence examples for by inserting an additional from inspiring English sources
For far field emission measurements, the back focal plane of the objective was imaged onto the entrance slit of the spectrometer by inserting an additional lens in the emission path one focal length away from the back focal plane of the objective and one focal length away from the projection lens in front of the spectrograph.
LIN is implemented by inserting an additional hidden layer with linear activation between the input layer and the first hidden layer.
Insertion of additional detector catheters may be performed with the purpose of optimizing detector positioning, e.g. by inserting an additional interstitial needle for housing a dosimeter probes in the tumour region.
To avoid Harlequin syndrome, left ventricular output must be reduced by inserting an additional drainage cannula (into the right ventricle, pulmonary artery or left ventricle) or by converting peripheral VA ECMO into central VA ECMO [22].
Instead, SLP does add a bias value to its weighted features, which can be mimicked also in our approach by inserting an additional constant value of 1 at the end of each original input FV (which the synthesizer can then select and scale among the other selected features).
For a connected graph G, define four related graphs as follows: 1. (S(G)) is the graph obtained by inserting an additional vertex in each edge of G. Equivalently, each edge of G is replaced by a path of length 2. The graph (S(G)) is called the subdivision graph of G. 2.
Tandem versions were generated by digesting EcoRI/Xba and inserting an additional linker (AATTTTGTCTTCCTGATCGGCGCCGCAGGAATACTCTTCGTATCTAGAGTGAATTCCTAA, newly situated restriction sites Xba-EcoRI are underlined).
Heart rate was recorded from inserting an additional electrode into left posterior leg of the turtle.
This defect can be mostly rescued by inserting a Ku-binding hairpin at other locations within the mutant tlc1Δ48 RNA, whereas inserting additional Ku-binding hairpins into wild-type TLC1 causes progressive telomere hyper-elongation (Zappulla et al., 2011).
