Suggestions(5)
Exact(2)
Several sports bankers said that by identifying a single investor, the Mets had given Einhorn leverage to demand a better deal before it is completed.
We confirmed the likely location of the replication terminus by identifying a single dif sequence (ACTTTGTATAATATATATTATGTAAACT, position 1 449 088 to 1 449 115) that aligns with the shift in GC skew (Fig. 1B).
Similar(58)
Still, those enzymes with particularly low vmax, as identified in this work, may very well be excellent candidates for those that exert the greatest degree of control over flux, but then the situation becomes continuous and non-linear, and cannot be captured by simply identifying a single enzyme with the lowest (in vitro) vmax.
Analysis by 3' RACE identified a single functional polyadenylation site, ATTAAA, within the 3'UTR of ABHD1 and a single polyadenylation signal, AATAAA, within the 3'UTR of Sec12.
Meta-analysis of the co-ordinates from these studies (unweighted by sample size) identified a single cluster of gray matter decrease in ADHD subjects compared with controls on sum-rank analysis.
Pressed by another reporter to identify a single Democrat who exemplified the corruption trends she described, Warren named Mary Jo White, who chaired the Securities and Exchange Commission from 2013-2017 under then-President Barack Obama. .
But a new report by the labor organization failed to identify a single nation that had responded to its call with any concrete action.
The method by Loguinov et al [ 32] identified a single differentially expressed gene at 0.125 μg/L-1 esfenvalerate (with no significant homology).
Routine surveillance of Campylobacter by HS serotyping and phage typing identified a single type that caused an outbreak associated with stir-fried food in the United Kingdom (34 ).
By pairing computation and experiment, we identify a single mechanical parameter that defines regimes in any motor ensemble wherein this mechanism is likely to be observed.
A recent study by Kim et al. [ 32] identified a single nucleotide polymorphism in the gene encoding the NaCl cotransporter SLC12A3.
More suggestions(3)
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com