Sentence examples for by gel extraction using from inspiring English sources

Exact(7)

PCR products of the ex vivo samples corresponding to rif group B and Pfmc-2TM were purified by gel extraction using the NucleoSpin Extract II Kit (Macherey-Nagel), cloned into the pCR2.1 TOPO vector and transformed into TOP10 cells (TOPO TA Cloning Kit, Invitrogen).

The PCR products were purified by gel extraction using the Qiaquick™ gel extraction kit (Qiagen, Valencia, CA), then cloned into pCR4 TOPO vector using a TOPO™ TA Cloning kit (Invitrogen, Grand Island, NY).

All PCR-derived probes as well as the 1.9-kb human dystrophin cDNA-specific Eco32I fragment used as an internal vector probe were purified by agarose gel electrophoresis followed by gel extraction using the QIAEX II system (Qiagen) according to the instructions provided by the manufacturer.

Single PCR products were diluted to 30 ng/µl or purified by gel extraction using the QIAquick Gel Extraction kit (Qiagen, Mississauga, ON, Canada), according to manufacturer's instructions and either sent to Canadian Centre of DNA Barcoding, Guelph, ON for DNA sequencing or sequenced directly using BigDye v3.1 reagents on at NAPS unit at University of British Columbia, BC.

The inverse-PCR products were purified by gel extraction using the QIAquick Gel Extraction Kit (QIAGEN) before being sequenced as above.

Digested cDNA was electrophoresed on 1.2% TBE agarose gels and size-selected for transcripts >800 bp in length by gel extraction using a Qiaquick gel purification kit (Qiagen, Valencia, CA).

Show more...

Similar(53)

LIC expression vectors (10 µg) were cut with 10 U PmeI in a 20-µL reaction volume and purified from contaminating stuffer fragment and undigested vector by gel-extraction using the NucleoSpin Extract II kit (Macherey & Nagel, Düren, Germany).

Size selection (200 400 bp) of the final PCR product was done by agarose gel electrophoresis and gel extraction using the Nucleospin extraction kit (Macherey & Nagel).

The positive PCR products were purified by gel extraction by using the QIAquick Gel Extraction kit (QIAGEN) according to the manufacturer's instructions; they were then sequenced on an ABI Prism 3130 automated sequencer (Applied Biosystems, Foster City, CA, USA), according to the manufacturer's instructions.

The first PCR was performed with the following primers: MEK1-cloning-F: 5′- CACCATGCCCAAGAAGAAGCG -3′ and MEK1-ins3 bp-R: 5′-CTGCTTCTGGGTTCTAAGAAAAGGCCTCAAGGCGCT-3′, and the PCR product was isolated by gel extraction and used in the second PCR as a forward primer in combination with the following primer: MEK1-cloning-R: 5′- TTAGACGCCAGCAGCATGGGT-3′.

The products obtained were purified by gel extraction and elution using HiPure columns (Roche Applied Science).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: