Your English writing platform

Write in English at your best with Ludwig

Register

Sentence examples for by first amplifying the from inspiring English sources

Ai Feedback

Is your sentence correct in English?

Log in and get your AI feedback from Ludwig.

Exact(7)

By first amplifying the DNA sequence and then analyzing the product, quantification was exceedingly difficult since the PCR gave rise to essentially the same amount of product independently of the initial amount of DNA template molecules that were present.

The csoS4A (GenBank AAC32553.1) and csoS4B (GenBank AAC32554.1) expression clones in the pET-22b vector (Novagen/EMD, Gibbstown, NJ) were generated by first amplifying the csoS4A and csoS4B coding sequences from pTn1 [30] using PfuUltra II DNA polymerase (Stratagene, La Jolla, CA) with primer pairs oAMscI/oArXhoIns and oBfNcoI/oBrXhoIns, respectively (Table S1).

The MER48 promoter deletion plasmid constructs were generated by first amplifying the MER48 element specific to EVADR using primers oHL_0011 and oHL_0005.

The 16 base pair motif was deleted using overlap extension PCR by first amplifying the 3' 641 base pairs of the RAP3 5' UTR using primers RAP3-5UTR-del-F (TAAAAAAAAAGGAAAAGAAAATTAAAGTATTATTTTTAAATAAAAAATAAAATAAAATAAACTCTCTTTTGAATGAAT) and RAP3-5UTR-R.

Plasmid pAM7904, containing an HA-tagged allele of TRK1, was constructed by first amplifying the TRK1 locus from wild-type genomic DNA [prepared as described (Burns et al., 1996)] using oligonucleotides GT127 and GT128 (Table 1), both of which contain BamHI sites.

Constructs used for protoplasts transfection were generated by first amplifying the full-length open-reading frame (ORF) of the corresponding genes by RT-PCR using RNA isolated from 10-d old, light-grown Arabidopsis seedlings, then cloning the PCR fragment in frame with an amino terminal HA or GD tag into the pUC19 vector under the control of the double 35S enhancer promoter of CaMV [ 36, 39].

Show more...

Similar(53)

A second set of normalized libraries (MMN-2 and MLN-2) were prepared by Creative Genomics, Corp. (Port Jefferson Station, New York) from 15 micrograms of total RNA by first amplifying cDNA with the Creator™ SMART™ cDNA Library Construction Kit, and then normalizing the product with the Trimmer-direct Kit (Evrogen #NK002).

To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse).

The pBluescript KS hTR expression vector was generated by first amplifying HeLa genomic DNA with the following primers that contain engineered sites for SacI and EcoRI (underlined) designed by using the human TERC NG_016363.1 sequence: 5′-GCC GAGCTCCGGGTTGCGGAGGGTGGGCCTGGGAG-3′ and 5′-GCC GAATTCCCATTGCCGGCGAGGGGTGACGGATG-3′.

AGT M235T polymorphism was studied by first amplifying a 104 bp long fragment of the AGT gene using the following primer sequences: sense- 5'CCGTTTGTGCandGCCTGGCTCTCT3', antisenseense: 5'CAGGGTGCTGTCCACACTGGACCCC3'.

For glc7-E101Q rexperimentsiments, a GLC7 was cloned into the integrative plasmid pRS306 by first amplifying a PCR product from genomic DNA that contained the entire GLC7 ORF and 0.5 kb 5' promoter sequence and 0.3 kb 3' UTR, digested with KpnI and SacI and ligated into pRS306 [ 67], resulting in pGLC7-3.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: