Sentence examples for by direct reaction using from inspiring English sources

Exact(1)

The possibility of hydrogen production by direct reaction using waste materials was also examined in an attempt to determine a more environmentally friendly hydrogen production method.

Similar(59)

The bound Aβ40 was detected by TMB reaction using HRP-conjugated BA27 antibody directed against the C-terminus of Aβ.

Per microarray experiment, 1.0-μg aliquots of aRNA were labeled with Cy5-dUTPs (Amersham Biosciences, Buckinghamshire, UK) by direct incorporation during a reverse transcriptase reaction using the CyScribe kit, according to manufacturer's instructions (Amersham Biosciences).

A series of well-ordered experiments demonstrated that shape and size of as-synthesized nanostructures can be adjusted effectively by directing reaction conditions such as alkalinity of reaction medium (concentration of KOH), reaction time and use of different surfactants.

Single- and multiple-base changes and deletions were introduced by Pfu-turbo polymerase-based chain reaction, using mutagenic oligonucleotides and the QuikChange site-directed mutagenesis kit (Agilent, Santa Clara, CA).

We varied the NiO loading to investigate the RWGS reaction using NiO/SBA-15 obtained by direct synthesis method.

Between 3 and 20 positive colonies from each reaction were screened by direct PCR using primers TOPO_F (GGCTCGTATGTTGTGTGGAATTGTG) and TOPO_R (AGTCACGACGTTGTAAAACGACGG).

Fragments with aberrant mobility, detected on PTT or HA gels, were sequenced on an independently amplified polymerase chain reaction (PCR) product by direct sequencing using the Thermo Sequenase Primer Cycle Sequencing Kit, or the Thermo Sequenase Cy5 Dye Terminator Cycle Sequencing Kit (Amersham Biosciences), and analysed on the ALF express™ DNA sequencer (Pharmacia).

CuS nanoflowers, fabricated by an element-direct-reaction route using copper and sulfur powder, were loaded on rutile TiO2 (CuS/TiO2) at low temperature.

The endpoint reading of the microagglutination reaction was reported as the serum dilution at which 50% of the leptospires were agglutinated by direct observation using inverted field microscopy.

A complex three-dimensional (3D) feather-like AlN nanostructure was synthesized by a direct reaction of high-purity Al granules with nitrogen using an arc discharge method.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: