Sentence examples for by assessing transcript levels from inspiring English sources

Exact(1)

We characterized nine of these mutations in greater detail by assessing transcript levels throughout development, morphological changes in the mushroom bodies, and restoration of control levels of aggression in revertant alleles.

Similar(59)

To measure the changes in splicing more precisely, we assessed transcript levels by quantitative RT PCR in two HGPS cell lines (AG03513 and GM01972).

In order to assess transcript levels by RT-qPCR, specific primers for the PopTLP1 gene (Poptr_0001s09570 in P. trichocarpa genome; 5' CCAGACTTGGTATCTTAATG; 3' GTTACCAAACTGATTTAACG) were designed and quantitative PCR was carried out as previously described [ 63], with technical and biological duplicates.

The purity of the SC populations isolated with our protocol was compared in different muscle biopsies by assessing the transcript levels of the SC marker Pax7.

To assess whether decreased invasion observed in vitro and in vivo is associated with changes in EMT markers expression, we performed qPCR to assess the transcript levels of EMT markers genes SNAI1 and ZEB2.

This increased cell death response was paralleled by attenuated activation of autophagy as assessed by WIPI1 transcript levels (Supplementary Figure 2e).

Transcript levels were determined by assessing the level of the DsRed portion of the transgenes by qRT-PCR.

Hh signal transduction dramatically decreased, as assessed by Gli1 transcript level in tumors.

The C. glabrata strains carrying plasmids with the phagocytosis-induced ACO2 and LYS21 promoters were used to infect J774A.1 cells and expression from the promoters was assessed by measuring GFP transcript levels using qRT-PCR.

To assess chondrocyte responses, transcript levels, histology and immunohistochemistry were used to assess changes in cell viability and in cartilage matrix composition, including collagen type II and aggrecan.

Additionally, we also assessed for the transcript levels of β-III tubulin in these differentiating NSPCs by qRT-PCR.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: