Sentence examples for by annealing two complementary from inspiring English sources

They were all generated by annealing two complementary oligonucleotides (e.g., fabA_she-BD-F plus fabA_she-BD-R, in Table 2) through the incubation at 95°C in TEN buffer (10 mmol/L Tris-HCl, 1 mmol/L EDTA, 100 mmol/L NaCl, pH 8.0) for 5 min followed by slow cooling to 25°C.

With an exception of fadM probe (PCR products) (Feng & Cronan, 2009b), all of the FadR-recognizable probes were prepared by annealing two complementary primers (Table 2) by incubation in TEN buffer (10 mmol/L Tris-HCl, 1 mmol/L EDTA, 100 mmol/L NaCl, pH 8.0) at 95°C for 5 min followed by slow cooling to 25°C and then digoxigenin (DIG) labeling by terminal transferase with DIG-ddUTP (Roche).

A Ter site (bold) was synthesized by annealing two complementary oligos: CCGGC CACTTTAGTTACAACATACTTATTAT CGATAATAAGTATGTTGTAACTAAAGTGG Following annealing, these oligos form a double stranded Ter site with ClaI and NgoMIV overhangs.

The DNA fragment encoding each shRNA was generated by annealing two complementary oligonucleotides (Eurogentech) and the resulting double-stranded DNA fragments were inserted between the BbsI and BamHI sites of pcDNA-ΔU6wt pcDNA-ΔU6wt

The multiple cloning site was assembled by annealing two complementary synthetic oligonucleotides (shown divided at each feature); the upper oligo (5'-3'): TCGA ACCGGT ACTAGT GCTAGC GCTAAGC TGTACA ACGCGT GGCGCGCC CCCGGG TTAATTAA AACGTT CACGCAGTG A, and the lower oligo (5'-3'): CTAGT CACTGCGTG AACGTT TTAATTAA CCCGGG GGCGCGCC ACGCGT TGTACA GCTTAGC GCTAGC ACTAGT ACCGGT.

Pcpt, a truncated version of the PPCC6803 cpcB promoter, was constructed by annealing two complementary, phosphorylated oligonucleotides.

A third derivative, SynE- T, conSynE- Tof a tandem version of a SynE and was consisteded by initially annealing twofcomplementary oligonucleotandem

A protein called RecO helps to anneal two complementary DNA strands together with the help of the RecR protein.

The plasmid pGDB-C3– rfa2 -D x was constructed by annealing five overlapping complementary primers (AspA-E; Table S3), followed by insertion of this fragment into pGDB-C3– RFA2 partially digested with EcoRI– HpaI.

The inserts were generated by annealing two oligonucleotides (Table 1) with a central, overlapping, complementary region and then performing a primer extension with DNA Polymerase I, Large (Klenow) Fragment.

The H1-promoter-driven shRNA cassettes were constructed by annealing two primers containing the 19-nt sense and reverse complementary targeting sequences with a 9-nucleotide loop -TTCAAGAGA- and flanking Mlu1 and Cla1 cloning sites (the sequences of shRNA were shown in the supporting information Table S1), and then cloned into the 3'-end of the H1 promoter in the LVTHM plasmid [35], [36].