Sentence examples for by annealing the complementary from inspiring English sources

Exact(1)

Rad59 then collaborates with Msh2-Msh3 and Rad1-Rad10 to coordinate the removal of the non-homologous tails created by annealing the complementary segments of the 3' single strands.

Similar(59)

A labeled double-strand DNA (dsDNA) oligo was prepared by annealing the two complementary oligos by cooling from 95°C to 25°C at 1°C/minute in a PCR thermocycler.

At the same time, a scrambled 39 bp DNA fragment formed by annealing the following complementary oligonucleotides (5′- GTACGGAGTATCCAGCTCCGTAGCATGCAAATCCTCTGG-3′) and (5′-CCAGAGGATTTGCATGCTACGGAGCTGGATACTCCGTAC -3′) was used to assay non-specific binding.

These four model TLS systems were prepared by annealing the 19-mer modified strand with complementary strands of variable lengths (n – 1, n, n + 3, and n + 9; n is the lesion site).

The ds attI1 containing donor substrate (100 bp) was generated by annealing the 5'32P radiolabeled oligonucleotide AttI1 (5'-ACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAATGAGCATCATTGC-3') with the complementary 5'32P radiolabeled oligonucleotide AttI1'.

The dsattC containing donor substrate (120 bp) was obtained by annealing the 5'32P radiolabeled oligonucleotide AttC2 (5'-CGCCCGTCTAACAATTCGTTCAAGCCGACGTTGCTTCGTGGCGGCGCTTGCGTGCTACGCTAAGCTTCGCACGCCGCTTGCCACTGCGCACCGCGGCTTAACTCAGGCGTTAGATGCACT-3') with the complementary 5'32P radiolabeled oligonucleotide AttC2'.

The attC containing donor substrate (120 bp) was obtained by annealing the 5'32P radiolabeled oligonucleotide AttC2 (5'-CGCCCGTCTAACAATTCGTTCAAGCCGACGTTGCTTCGTGGCGGCGCTTGCGTGCTACGCTAAGCTTCGCACGCCGCTTGCCACTGCGCACCGCGGCTTAACTCAGGCGTTAGATGCACT-3') with the complementary one AttC2'.

A 50-mer target DNA substrate containing one TpA dinucleotide was prepared by annealing the 50 nt sequence 5′ AGCAGTCCACTAGTGCACGACCGTTCAAAGCTTCGGAACGGGACACTGTT with its complementary strand.

The attI1 containing donor substrate (100 bp) was generated by annealing the 5'32P radiolabeled oligonucleotide AttI (5'-ACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAATGAGCATCATTGC-3') with the complementary one AttI'.

MicroRNAs regulate the gene expression by annealing with the complementary mRNAs, thus preventing their translation or inducing their degradation [ 3, 4].

The DNA fragment encoding each shRNA was generated by annealing two complementary oligonucleotides (Eurogentech) and the resulting double-stranded DNA fragments were inserted between the BbsI and BamHI sites of pcDNA-ΔU6wt pcDNA-ΔU6wt

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: