DNA sequences of AVD, AVR2, AVR4, AVR6, AVR-A, AVR-B, AVR-C and BBP-A and BBP-B were aligned exon by exon and intron by intron using Clustal X in multiple alignment mode with default values for both pairwise and multiple alignment parameters.
In this study, site-directed gene disruption was accomplished by integration of a group II intron using the ClosTron system (Heap et al. 2007).
Gene-specific primers (Additional file 7, Table S7) were designed on regions not interrupted by introns using Quantprime software [ 60], tested for the specificity of each amplification reaction.
Schering-Plough sells Intron A, used to treat melanoma.
Spliceosomal introns are flanked by GT and AG dinucleotides in the vast majority of known introns, while about 0.1% are U12 AT-AC introns[ 27] and a very small proportion of known introns use other non-canonical splice boundaries.
For example, directly visualizing nuclear spatial distribution of minimal intron by using interphase fluorescent in situ hybridization (FISH) and establishing mutated genes where minimal introns are artificially lengthened and/or disrupted would provide very important evidence for their function.
By searching the intron sequence using CURAY (where R is purine and Y is pyrimidine) as the primary motif, UURAY as the secondary motif, and a modified YURAY as the third motif (See Methods), we located the branch site for almost all of the SJs (14642 of total 14678).
To resolve these contradictions, it is important to analyze the evolution of introns by using a probabilistic model that minimally relies on arbitrary assumptions.
To resolve these contradictions, it is crucial to analyze the evolution of introns by using a model that minimally relies on arbitrary assumptions.
The pKEK1220 plasmid was constructed by retargeting the Ll.LtrB intron in pKEK1140 using intron binding site primer IBS (5'-AAAACTCGAGATAATTATCCTTAAAAAACCCTCGTGTGCGCCCAGATAGGGT G), and two exon binding site primers EBS1 (5'-CAGATTGTACAAATGTGGTGATA ACAGATAAGTCCCTCGTACTAACTTACCTTTCTTTGT) and EBS2 (5'-TGAACGCAAGTTTCTAATTTCGGTTTTTTTCCGATAGAGGAAAGTGTCT) as described previously [18].
