Sentence examples for by amplifying the coding from inspiring English sources

Exact(5)

The C-terminal truncation construct papl-1::apl-1ΔIC::gfp was generated by amplifying the coding region of apl-1 excluding the sequence for the last 36 amino acids.

A construct to express Dictyostelium cyclin C with an N-terminal FLAG tag under the actin 15 promoter (pDXA[act15::FLAG-cycC]) was generated by amplifying the coding region of CycC from the ATG to the stop codon by PCR from genomic DNA, with the FLAG tag incorporated into the N-terminal primer.

Mammalian expression vectors for FLAG epitope-tagged versions of STAT3α and STAT3β were constructed by amplifying the coding region of human STAT3α and STAT3β genes by PCR to create the desired restriction enzyme sites (HindIII and XhoI) for subcloning into the pXJ40-FLAG vector.

The UAS Maf-S fly stock was generated by amplifying the coding seqUAS Maf-Sthe Mafly gene by PCR ustockembryonic cDNA as template and cloning it into the XbaI site of the previously described pUAST-3×HA vector (Sykiotis and Bohmann, 2008) in frame wash the C-terminal 3×HA tagenerated

3D7 parasites expressing the α subunit of CK2 as a 3× HA fusion protein were generated by amplifying the coding region of PlasmoDB accession number PF3D7_1108400 from 3D7 gDNA with subsequent cloning in the KpnI and AvrII restriction sites of the transfection vector pARL 1a-3×HA using AvrII and XbaI compatibility.

Similar(54)

The bicistronic reporter construct pEF-GFP-T2A-DsRed2 was made by amplifying the code for DsRed2 from pDsRed2-N1 (Clontech) using the DsRed2-C primer set, cutting the PCR fragment with BamHI and XhoI, and cloning it into the BglII and XhoI sites of pEF-GFP-T2AdelSTOP pEF-GFP-T2AdelSTOP pEF-GFP-T2AdelSTOP

A plasmid for expression of HA-tagged Malectin was prepared by amplifying the protein coding sequence from the full-length cDNA clone, product IRAUp969B111D (Imagenes) with the primers CACCGAATTCCCACCATGCTGGGAGCCTGGGC and CCCACCCTCGAGTCA CAACCGGCAGAGGCAGAA.

To complement the phenotypes, rescue plasmids pGPD-CAS1, pGPD-CAS2 and pGPD-CAS3 were constructed by amplifying the entire coding regions with primer pairs cynT1-GFP-f/cynT1-BamHI-r, cynT2GFP-f/cynT2-BamHI-r and cynT3GFP-f/cynT3BamHI-r, respectively.

The pEGFP-KLF6 plasmid was generated by amplifying the complete KLF6 coding sequence from the pCIneo-KLF6 construct [1] using the primers fwd-KLF6pCIneo and rev-KLF6pCIneo (Table S1).

The pFLAG2AB-cateninY228F explasmidn plasmid was generated by amplifying the mouse catenin1AY228F coding sequence from pRc/RSV-mctn-1A/228F pRc/RSV-mctn-1A/228F pRc/RSV-mctn-1A/228Fersity) and then subcloningifttofpcDNAlbert Reynoldsor (gift of Scott Weed, West Vanderbilt Universitycut with Kpn1 and EcoRI.

The transgene sei-3′UTR was generated by amplifying the same sei coding sequence plus its 3′UTR (sei-RA, length = 95) with primers 5′-AAAAGCGGCCGCATGT-CCCACAAATCTTGCGT-3′ and 5′-AAAATCTAGATTTTCGGTTAGGACCTTTATTGC-3′.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: