Sentence examples for by a two site from inspiring English sources

Serum OPG was measured by a two site immunoassay using antibodies raised against recombinant human OPG (Biomedica, Vienna, Austria).

Serum TGF β1 was measured by a two site ELISA using specific antibodies raised against human recombinant TGF β1 (IBL, Hamburg Germany).

Serum TIMP-1 was measured by a two site ELISA using specific antibodies raised against human recombinant TIMP-1 (Quantikine® R&D, Minneapolis, USA).

The assay for serum insulin was performed at the Diabetes Endocrinology Research Center Immunoassay Core Laboratory University off Washington), and quantified by a two site assay using a Tosoh 2000 auto-analyzer (Tosoh Biosciences Inc., South San Francisco, CA).

Serum C terminal crosslinking telopeptide of type I collagen (S-CTX) was measured by a two site assay using monoclonal antibodies raised against an eight amino-acid sequence from the C-telopeptide of human type I collagen by an automatic analyzer (Elecsys, Roche Diagnostic, Mannheim, Germany).

Generation of the GEF-dead variant (L386R/L387S) of the ARHGEF7 construct [32] was performed by a two step site-directed mutagenesis by using the oligonucleotide GATAAATACCCTACGCGGCTCAAAGAGCTCGAGA to introduce the L386R and thereafter the oligonucleotide GATAAATACCCTACGCGGTCCAAAGAGCTCGAGAGACA to introduce the L387S mutation.

"Now listings are all over the place — all that information is published by a million different sites," Ms. Herman said.

Using the traditional Cre/loxP system, it is also possible to create a transcription block by floxing two sites in the region preceding an exon.

The PWV can be determined either by placing a probe on two sites and recording the waveform simultaneously, or by recording the waveforms independently and comparing the time delay at both sites with a simultaneously measured QRS complex.

By comparing three sites — an organic farm in western Maryland, a park in a Baltimore suburb and the one by the inner harbor — Ziska planned to study three circumstances: the present (on the organic farm), the mid-century future as predicted by the climate-change panel (in Baltimore) and something in between (the suburban site).

Over the longer term, variation of the rainfall regime, within an area of generally similar rainfall, can be sufficient to influence crop management, as shown by a study of three sites in Syria by Keatinge et al. (1985), and at six sites in Botswana by Dennett and Rodgers (1986).