Sentence examples for by a template with from inspiring English sources

Exact(2)

The open-composition can be defined by a template with two component types.

The tips are formulated by a template with a set of types of predetermined common-sense relations (contain, is a type of, is about, is the opposite of, is used for, is within, etc).

Similar(58)

By using a template with similarly-sized regions, we avoided any bias introduced by larger regions having more connections or greater probability of grey matter lesions (Supplementary Fig. 1).

By creating a template with gel and treating it to mimic the relationship between the brain's gray matter and white matter, Mahadevan along with other researchers discovered that they could reproduce the brain's folds.

Pulsatile patterns were discovered by convolving a template with the expression signals [ 137].

DOI: http://dx.doi.org/10.7554/eLife.06249.017 10.7554/eLiFigure4 figureigure 4—figure supplement 2. Nucleosome remodeling by SWI/SNF on a template with the Gal4 binding site separated from the 601NPE by 24 bp.

Thus an image at 5 10 min at which time there is virtually no uptake of the monoclonal antibody by the cancer, acts as a template with which to compare the later images.

By using the Multi Site-Directed Mutasenesis Kit (Medical Biology Laboratemplate a template with wild-type hTFIIEα cDNA plasmid or a hTFIIH p62 cDNA mutant in which a NdeI site was disrupted by changing the third nucleotide of the 45th histidine codon of wild-type hTFIIH p62 cDNA, T to C, various oligonucleotide-mediated point mutants were created (Kunkel et al, 1987).

Split-GFP constructs were generated by PCR using pEGFP-N1 as a template with the following primers: Split-GFP 1 157 was amplified using the forward primer GCAAATGGGCGGTAGGCG reverse primer GATCGCGGCCGCTTACTGCTTGTCGGCCATG and subcloned into Age1 and Not1 of SFpEGFP-N1.

The pYeAβARCYGFP plasmid was created by overlapping PCR using pYeαAβARCYGFP as a template (with oligonucleotides 705, 706, 859 and 860).

This was done by comparing pathways, using gDNA as a template, with the expression levels of RNA.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: