The possibilities and pitfalls of the new system are on vivid display in a probing analysis by the University of Chicago Consortium on Chicago School Research, an influential research group.
A p value of cutoff <1 × 10−8 was enforced on the SNP analysis to filter out false positives, and a probe-by-probe analysis was performed on each SNP to validate its likelihood.
†MAC-X is a mycobacterium that tests positive by DNA probe analysis for M. avium complex but is negative with specific M. avium and M. intracellulare probes and PCR analysis.
Our group recently reported a study showing improved elucidation of biological processes by single-probe analysis.
Routine use of real-time nested RT-PCR that distinguish lineage 1 and 2 by hybridization probe analysis (12) resulted in rapid detection of a lineage 1 strain as an emerging pathogen in the country.
Stratification for documented reflux (by radiographic contrast or by pH probe analysis), concomitant use of methylxanthines or ranitidine, developmental age, feeding volume, and respiratory support did not identify a subgroup of patients whose apnea improved with antireflux treatment.
Figure 7 plots the dependence of voltage versus current obtained by the four-point probe analysis for all samples.
Although we were not able to quantify subtle differences, if any, in gene expression between control- and hbox12-injected embryos by a mere analysis of Dig-probe staining, the overall fraction of embryos showing defective expression of nodal, gsc, and tbx2/3 was somewhat consistent with that of embryos that ultimately displayed unambiguous loss of DV polarization at later stages.
Genomic DNA prepared from the resistant clones was analyzed by PCR using TGAGATGGATGTGCGTGAGGGATTAAGCTC and CACCTTGATGCCGTTCTTCTGCTTGTCGGC, and by Southern analysis with a probe located in intron 1 (probe: PCR fragment amplified using TGCATCACGCTAACTTGTCATGAC and TTGGCACACTCTCCAAGAGAAATG). The evaluation of 144 independent clones revealed one that had been correctly targeted.
Confirmation that the targeting vector was not inserted into an ectopic genomic locus was obtained by Southern blot analysis with a probe for a coding region of gfp.
