Sentence examples for by a parallel reaction from inspiring English sources
Maleic anhydride and carbon dioxide are found to be formed from furfural by a parallel reaction scheme.
The main degradation mechanism described by a parallel reaction rather than by a sequential reaction for dechlorination of TCA in Hb/SA MWCNT GE system was proposed.
Each reaction rate was corrected by subtraction of the background rate of DCPIP reduction by NRH estimated experimentally in a parallel reaction containing the same components except enzyme.
A parallel reaction without TrxR was performed to quantified non-specific NADPH oxidation and used for background correction.
A parallel reaction omitting digoxigenin-dUTP was performed, because digoxigenin incorporation into the amplicon can be checked through the size shift of the amplicon by gel electrophoresis.
The spectrometer was blanked against a parallel reaction made with untransformed MC4100.
The mesomixing scale was adjusted through different ways in these mixers and the micromixing performance was characterized by a parallel competing reaction.
Micromixing was characterized by using a competitive parallel reaction system (iodide-iodate).
The formation of acrolein, acetaldehyde, and total combustion products is described by a series-parallel reaction network.
Internal controls for the reverse transcription/polymerase chain reaction (RT-PCR) reaction was performed by running parallel reaction mixtures with the housekeeping gene GAPDH: 5′ATCTTCCAGGAGCGAGATCC 3′ and 5′ACCACTGACACGTTGGCAGT 3′.
