Sentence examples for by a forward primer from inspiring English sources

The hsa-mir-200c sequence was amplified from the genomic DNA of humans by a forward primer: '5′-CAACAGAAGGCTCGAGGAAGTGTCCCCAGGGACTC-3′' and a reverse primer: '5′-ATTCTGATCAGGATCCAACGCTCTCAGCTCAAGACG-3′'.

The chloroplast-specific PGK was amplified and detected by a forward primer (5′-GCCTTCTGTTGCAGGTTTCC-3′) and a reverse primer (5′-ATTCCTCCACCCAAAAGCAA-3′).

A probe (ca. 300 bp) from the puromycin resistance gene was amplified by a forward primer (5′-TCACCGAGCTGCAAGAACTC-3′) and a reverse primer (5′-AAGCCGAGCCGCTCGTAGAA-3′) using the gene trap vector pGen-loxP-SA-IRES-Puro-pA-PGK-βgeo-pA as a template.

The capulet gene sequence was amplified from the cDNA clone LD24380 by using a forward primer containing a BglII restriction site and a reverse primer containing an XhoI restriction site.

As such, by using a forward primer in PML exon 3 and a reverse primer that spans the exon 4/7a junction (see Fig. 2B) we were able to examine the expression of several PML Ib like transcripts.

By using a forward primer recognizing a sequence at the end of exon 3 of PML and a reverse primer recognizing a sequence at the beginning of exon 9 we were able to examine the internal exon splice variants of the PML I transcript which is believed to be the predominant PML isoform [41].

An RT-PCR strategy was designed to detect specifically RNA resulting from cis- and trans-splicing events by using a forward primer E22-F (arrow A in Fig. 1B) specific for E22, and a reverse primer pSMD2-R1 (arrow B) specific for a sequence upstream the polyA signal in the dystrophin minigene and TS molecules.

The first PCR amplification was from intron 1 to the end of exon 2 by using a forward primer (5′-CTAAAGAGAATGACCTTGGTGGGT TGA G-3′) and a reverse primer (5′-CACAGTAGCTTCAAAACTGTTCGA-3′).

> Open reading frames (ORFs) selected for complementation of markers were cloned by using a forward primer 200 bases 5′ of the start codon, and a reversed primer 200 bases 3′ of the stop codon.

This was achieved by pairing a forward primer specific to the upstream promoter (UPF: CCTGGGCTTTCAAGAGAACCACATG) with an L-specific exon 2 reverse primer (LE2R; CCCAGCACGAAGTAGCCAG) and in a separate reaction, pairing LE2R with a forward primer upstream of OPN1LW and OPN1MW (LM1F; GGTGGGAGGAGGAGGTCTAA).

By using a forward primer located downstream of the in-frame intron in exon 4 (DSX8F) and reverse primer within the putative male-specific/common exon 6 (DSX6R), we generated an amplicon spanning a ca. 1,079 bp exon (exon 5, Fig.  4b) specific to the female that was spliced to exon 6 after removal of 2.9 kb of intronic sequence (Fig.  1).