Sentence examples for built on length from inspiring English sources

Significance of enrichment was inferred on ME counts with three standard statistical tests (binomial, hypergeometric, and Poisson models), the wordle plots (http://www.wordle.net/ ) were built on length since it is more representative of a given ME contribution.

In case of variable length peptides, the models were built on variable length data.

Our findings build on this work by including information on length of stay and demonstrating association with longer but not shorter admissions among infants under 1 year old.

the B-UNCD with boundary grain size around few nanometers of has been successfully synthesized, and three groups of reasonable straight diamond NWs with the same diameter and different lengths were built on one single substrate.

The index is built on subsequences of length k, called " k-words".

Perfect reconstruction multirate filter banks theory was built on the assumption of infinite length signals.

In "Five Minutes of Heaven," a feature-length talkathon built on a sketchy premise, some unpersuasive psychology, a pinch of politics and strong star turns from Liam Neeson and James Nesbitt, the appeal of all those words runs out long before the director Oliver Hirschbiegel turns off the spigot.

The final PgiC gene tree (Fig. 2b) was built on 109 consensus sequences ranging in length from 1619 to 1674 bps.

The final ncp GS gene tree (Fig. 1b) was built on 80 consensus sequences ranging in length from 873 to 921 bps.

FISH assay was performed on one sample from each period, as previously described [ 88], using the DNA probe 50 bp in length (biotin-5′AAAGGGAGGGAGAGACCAAAGAAGTAGATGATGATGATGATGAAGTGATC 3′) built on the SRY sequence.

This centuries-old traditional Korean art form features a specially trained singer who, together with a percussionist, presents evening-length song narratives built on folk tales and originally developed to provide both entertainment and moral education to the listeners.