Sentence examples for built by inserting from inspiring English sources

The differential equation was built by inserting randomness in the dispersion coefficient, which added a stochastic term to the model.

For silver containment inside the coating at high temperatures, a multilayer architecture was built by inserting a TiN diffusion barrier layer in the composite coatings.

The MLV-HIV vector was built by inserting the PCR-amplified −413 to −62 fragment of the MLV U3 region at position −40 in the HIV LTR of the pRRLsin-40.GFP vector [51], and adding an internal SV40-driven ΔLNGFR expression cassette.

A pMEG1-derivative pMEG1s plasmid was built by inserting phosphorylated and annealed SC126 (CCGGGAACGTAGTGACAGGTAC) and SC127 (CTGTCACTACGTT CCCGGGTAC) oligonucleotides into the unique KpnI site of pMEG1.

Therefore, most mammalian V2R constructs were build by inserting a genomic DNA fragment containing the second intron (encompassing amino acid position 68 (2.33, numbering of the relative position within GPCR [55]) to amino acid position 321 (7.49) of the respective mammalian ortholog into the double-tagged human V2R-pcDps expression plasmid keeping the human N and C termini.

So a context-free sequence also began with a rattle-warble base but built up by inserting new sounds in the middle, such as rattle-rattle-warble-warble.

The model is highly interactive with powerful capabilities for system layout and configuration the canal and drainage networks that are built interactively by inserting and arranging nodes graphically.

On a recent day, frames were being welded from steel tubes in one corner of the floor, while on the other side of the room wheels were being built by a machine that inserted four spokes at a time until all 36 were in place.

The SB T2/OncZ transposon was built by modifying the previously characterized T2/Onc vector [10] by inserting the carp ß-actin promoter [33] (detailed cloning steps are provided in Methods S1.

All the inserts were built by clustered LTR positions, and each one of them assigned a unique ID, chromosome, orientation, sample ID, minimum LTR position, and maximum LTR position from the alignment.

In the original SOAPdenovo, scaffolds were built by utilizing PE reads starting with short insert sizes (~200 bp) followed iteratively to large insert sizes (~10 kbp) [ 3].