Your English writing platform
Discover LudwigSuggestions(1)
Exact(37)
Ray Lygo was a naval airman who transferred to surface ships, becoming a full admiral, Vice Chief of the Naval Staff, and briefly First Sea Lord, before moving on to be a captain of industry.
The service model of multi-service OFDM system is analyzed briefly first.
The main algorithms of the software are described briefly, first at ordinary temperature, then for any field of high temperatures due to fire situation.
Briefly, first stage culture was initiated by inoculating 25 mL of sterile liquid medium with a loopful of freshly grown culture, under laminar airflow cabinet.
Two of these radiation dose-saving techniques should be mentioned briefly: First, prospectively ECG-gated CT coronary angiography, also called the "step-and-shoot" mode, has been introduced.
Nukhaev, who was briefly first deputy prime minister in the rebel government, is now living in exile, reputedly coordinating the finances of the rebel movement.
Similar(23)
Briefly, second stage suspension cultures were filtered and the cells were washed with di-potassium hydrogen phosphate buffer (pH 6.8) followed by distilled water.
Briefly, first-strand cDNA was synthesized from 1 µg of total RNA using a Reaction Ready™ first strand cDNA synthesis kit (SABiosciences, Frederick, MD). cDNA was subjected to real-time quantitative PCR using Bio-Rad iCycler iQ Multicolor Real-Time PCR Detection System Bio-Rad Life Science ResearchHerculesles, CA).
Briefly, first-strand cDNA synthesis with an oligo dT -containing adaptoligo dT -containingmed adaptor for 50 min, followed by amprimeration of the target cDNA wash performedTat DNA polymerase (Invitrogen, Carlsbad, CA, USA) using a specific primer designed based on pyrosequencing data as well as the abridged universal amplification primer (AUAP) (5' GGCCAGGCGTCGACTAGTAC).
Briefly, first-strand cDNA was synthesized by a reverse transcription reaction with T7 oligo dT) primers.
Briefly, first-strand cDNA was reverse transcribed from 1.2 μg (H. erato) and.7 μg (H. melpomene) total RNA.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com