Sentence examples for brief a pair of from inspiring English sources

In brief, a pair of functions was defined to conduct wavelet transform the mother wavelet ψ(x)—representing the detail and high-frequency parts of a signal and the scaling function φ(x) representing the smooth and low-frequency parts of the signal.

In brief, a pair of complementary oligonucleotide primers containing the mutation (forward primer sequence 5′CTGCTGCGGCCGGTGCGCGTG3′ and reverse primer sequence 5′CACGCGCACCGGCCGCAGCAG3′, synthesized by Sigma-Genosys, Haverhill, UK) was used in a PCR reaction (95 °C for 1 min, 60 °C for 1 min, 68 °C for 16 min for 18 cycles) by using hERG in a modified pcDNA3.0 vector as a DNA template.

Her speech is as elegant as a little black dress and as brief as a pair of pants.

The Essex boy who turned up to last week's England media briefing in a pair of maroon loafers departed Glasgow Green feeling like he had diamonds on the soles of his shoes.

When at the beach, try to wear swim briefs under a pair of board shorts.

In December of 1957, after a brief career with a pair of professional burglars, Merle and a friend attempted to rob a highway restaurant.

Lord Feldman, top-drawer barrister and Oxford chum of Cameron's, denies that he was the senior Tory who made the remark about the party faithful in a brief exchange with a pair of political reporters as he passed their table in a Westminster restaurant.

As a prelude to the main adventure, Barney will have a brief parley with a pair of anonymous chaps played by Bruce Willis and Arnold Schwarzenegger (he is teased about his weight and his political ambitions), who withdraw without throwing a punch or firing a gun.

In brief, this method defines a pair of genes as "syntenic" if two genes in the query genome, that have at most three intervening genes, have homologs in the other genome separated by at most four genes.

Three of the others were in the squad leaving just one fresh face at kick-off, Everton's John Stones, who made his full debut after a pair of brief appearances off the bench during England's World Cup warm-up matches.

I'd like to start the Movie Club's discussion of John Cassavetes's "Faces," with a pair of brief quotes from Pauline Kael's essentially negative review of the film in the December 7 , 1968 issue of The New Yorker: The acting that is so bad it's embarrassing sometimes seems also to have revealed something, so we're forced to reconsider our notions of good and bad acting.