Your English writing platform
Discover LudwigSuggestions(2)
Exact(2)
The supplementary figure S7, Supplementary Material online shows origins of different regions based on breakpoints specific to the α710 strain.
Compared to previous studies [ 27, 36], this analysis resulted in a refined and comprehensive list of SDs representing likely chromosomal breakpoints specific to the songbird lineage.
Similar(58)
Ideally, breakpoints specific to animal species, disease, pathogen, drug, and the administration regimen (dose, route, duration, and frequency) should be used for the most clinically valid interpretations.
Mouse-human breakpoint absent in the human-rat comparison suggests the rearrangement is specific to the mouse lineage, i.e. mouse-specific breakpoint.
DNA gel showing PCR assays performed using oligo pairs from a control region and from breakpoint junctions specific to FRAG00062 using DNA from a diploid sibling (top panel) or FRAG00062 (bottom panel).
To assess the microdeletion breakpoints, specific primers (forward: 5'- ACTCTGAGGACAAAGCAGCGGA -3'; reverse: 5'-GTGCCACCAAGCCCGGCTAA -3') were designed in order to amplify the breakpoint region of the BRCA1 rearrangement (microdeletion involving the same exons described by [ 20].
HYDRA called a total of 1598 rearrangements (with the filtering scheme described in the Materials and Methods) in the two cell lines, with 88 predicted to be somatic breakpoints specific for WPE1-NB26 (Table 2).
Only one study examined MSI at chromosomal breakpoint cluster regions specific to haematological malignancies (Pabst et al, 1996).
There are two additional breakpoints on human chromosome 5: one is specific to SSC, and the other to CGO.
Indicative of a suitable reliability of our analysis pipeline, 68 rearrangements out of 86 (79 %) were confirmed by PCR across the breakpoint junction as either specific to BC1, specific to BC2, or shared.
There are two additional breakpoints on human chromosome 5: one is specific to squirrel monkeys, and the other to Goeldi's marmoset.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com