Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
Due to the semi-crystalline nature of amylopectin molecules in the granule, wild-type starch granules exhibit a birefringence pattern when viewed with polarized light as shown in Figure 3A for wild-type bread wheat and Figure 3E for durum wheat.
Similar(59)
Beauveria bassiana successfully established within, and colonized, bread wheat and durum wheat plants.
It compares the root system of bread wheat and 'Veery'-type wheat containing the 1RS translocation from rye.
The first branch within Triticeae had a value of 1.04 ± 0.02 and led to bread wheat and poulard wheat.
In the specific case of wheat HANDS uses the sequence similarity between the three A, B and D bread wheat subgenomes and the genomes of three extant diploid relatives of the original subgenome donors (Additional file 1: Figure S2).
In a series of experiments using durum and bread wheat cultivars, uptake and translocation of both Cd and Zn were higher in the bread wheat cultivar than in the durum wheat cultivar [ 7, 10].
Bread wheat: improvement and production, pp. 407-432.
In contrast, tetra-nucleotide repeats dominate in species such as bread wheat, grape and sugarcane.
Since bread and wheat products figure prominently in Uighur cuisine, they're working on installing a specialty oven to bake their own nan, a Uighur staple.
Gavuzzi et al. [ 67] compared 6 bread wheat, 6 durum wheat and 6 barley genotypes for physiological parameters following water stress, and found that bread wheat had the smallest water loss values.
For genotyping mutations, the primers TGGTCCACGTGGCCATC and CCAACTCCCATAGTTGAATAGACGA and probes ATTGGATGTGAGATTC, and TGGATGTGGGATTC were used for the durum wheat SBEIIa_A(W436*), the bread wheat SBEIIa_A(W436*) and the bread wheat SBEIIa_D W432*) mutations.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com