Sentence examples for brain samples using from inspiring English sources

Gene expression profiling in postmortem human brain samples using microarrays is a difficult and controversial area [22].

Signal intensities were normalized by the amount of heat-responsive protein 12 (housekeepersekeeper, found in individual brain samples, using primers HRSP12F (atgaatgactttggcactgtc) and HRSP12R (atggctacttatagtcatgcc).

As previously described [15], total RNA was prepared from diencephalic brain samples using a RNA-plus solution (Q-Biogen, Illkirch, France).

Demographic characteristics and risk factors profile are described in Table 2. RNA was isolated from frozen brain samples using the RNeasy® kit (Qiagen, Austin, TX, USA).

Total RNA was extracted from fresh blood, liver and brain samples using the TRIzol Total RNA Isolation Kit (Invitrogen), and mRNA was purified employing an Oligotex mRNA Spin-Column Kit (Qiagen).

Spleen sample preparation was similar to the preparation of brain samples using a methanol soak.

This lack of impact of age was expected as previous data indicates that changes in these sphingolipids across the ages of the brain samples used in our study would be extremely small and thus undetectable [57], [58].

Next, we determined if blocking c-Fos expression affects the bulk content of AP-1 transcription factor dimers by electrophoresis mobility shift assays (EMSA) performed with nuclear extracts prepared from the brain samples used in Fig. 5B.

14 In the brain samples used for this study the pH ranged between 6.1 and 7.2.

Authors thank NNTC for providing brain samples used for this study and Dr. Ashley Schoell (Los Angeles) for facilitating that.

The brain samples used in this study were registered to the Brain Bank for Aging Research BBARR) with the deceased's relatives' informed consent to carry out comprehensive research.