Sentence examples for brain gene expression levels from inspiring English sources

We compared brain gene expression levels in common gardened Fundulus heteroclitus from three independent, resistant Superfund sites to individuals from six nearby reference populations.

In the current study brain gene expression levels of autopsied LOAD subjects measured from the cerebellum (n = 197) and temporal cortex (n = 202) were used.

We used the SAGE approach to reveal the difference in brain gene expression levels between Baikal whitefish and omul and identified some of candidate genes involved in the divergence of these species.

In the HXB/BXH recombinant inbred (RI) rats, correlation analysis of brain gene expression levels with alcohol consumption in a two-bottle choice paradigm, and filtering based on behavioral and gene expression quantitative trait locus (QTL) analyses, generated a list of candidate genes.

Brain gene expression levels change significantly over lifetime, from birth till old age, and these changes follow distinct and evolutionarily conserved trajectories that reflect functional changes in the tissue (Lee et al., 2000; Lu et al., 2004; Somel et al., 2010).

These findings reported SNPs, GSTO1 rs4925 and GSTO2 rs156697, in AD and PD in association with disease risk, age at diagnosis, and brain gene expression level [ 11].

The sequences for the primers (5' to 3') used are as follows: Amfor -F: AATATAACTTCCGGTGCAACGTATT; Amfor -R: CGTTTGGATCACGGAAGAAAG; eIFS8-F: TGAGTGTCTGCTATGGATTGCAA; eIFS8-R: TCGCGGCTCGTGGTAAA; We evaluated the brain gene-expression levels of 9 SDI queens and 9 MDI queens (derived from two cohorts).

We suggest here that microarray experiments using brain-gene expression levels from psychiatric experiments (e.g. schizophrenia group vs non- schizophrenia group) can utilize microarray data not only for group mean effects (i.e. standard microarray analysis) but also, whenever possible, should evaluate expression levels by individual subjects.

Another study of AD in the human brain compared gene expression levels across six brain regions affected by AD at different stages of progression [ 20].

We also assessed associations with brain MAPT gene expression levels measured in the cerebellum (n = 197) and temporal cortex (n = 202) of LOAD subjects.

These two strains were chosen based on their differences in voluntary alcohol consumption (see Figure 1) and their differences in brain candidate gene expression levels determined using the CodeLink arrays.