Your English writing platform
Discover LudwigSuggestions(1)
Exact(2)
The resulting spatial vectors (estimated via PCA; normally one component for blinks and 2 components for ECG account for >90% of the topography) are added to the brain (forward) model.
This review has focused upon the concept of maximization of information, which is extremely important if we are to move our understanding of the brain forward.
Similar(55)
In order to confirm fractionation of RNA based upon poly(A) tail length, one TVN and all ePAT cDNA samples were amplified with the creatine kinase brain (CKB) forward primer (Supplementary file 1A) and the ePAT universal reverse primer 5′-AGCTCCGCGGCCGCG-3′; the resulting amplicons were visualized and analyzed as described above.
This stops your brain from racing forward and back in time and centers you in the present moment, thus relaxing you.
In soccer, even though "heading" is no longer allowed, if the head does come in contact with the ball or another player, the front of the brain will bang forward against the skull.
The present findings indirectly lend support to the extreme male brain theory put forward by Baron-Cohen (2005), and may cast some light on the mirror-neuron dysfunction in autism spectrum disorders.
Wells that contained embryos with no fos expression in the brain were taken forward for further analysis.
An 800 bp fragment was polymerase chain reaction (PCR -amplified from mixed stage medaka cDNA eye and brain using the forward PCR -amplifiedGACACCGTGGGAACTGG) and reverse primer (CTGATGGAGTCCGGTACATGCTG) designed to bind in exons 1 and 4 ofrombarhl2 (ENSORLT00000002844, EnsEmixed58).
Full-length zebrafish Aqp1b cDNA was amplified from total RNA extracted from adult brain using specific forward and reverse primers based on a predicted cDNA (see Additional file 3).
It pounces on their talents, picking their brains, pushing them forward.
That job will require the same resources, brain power, and forward-thinking solutions that the U.S. government will bring to Houston and Florida in the coming months and years.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com