Sentence examples for bp were performed using from inspiring English sources

Exact(2)

PCRs for GAPDH (278 bp) were performed using the primers AGACAGCCGCATCTTCTTGTGC and CTCCTGGAAGATGGTGATGG. Thirty cycles (95°C for 1 min; 55°C for 1 min; and 72°C for 1.5 min) were performed.

Associations with birth weight and BP were performed using Pearson's partial correlation after adjusting for confounder i.e. gestational age, maternal age and BMI in NC and PE as separate groups.

Similar(58)

Paired-end sequencing (76 bp) was performed using the Genome Analyzer IIx (Illumina Inc).

Paired end sequencing (250 bp) was performed using a MiSeq v2 500 cycle kit (Illumina).

Additional filtering for homopolymers and read size (< 75 bp) was performed using custom written code.

Paired-end sequencing (2 × 75 bp) was performed using TruSeq SBS kits (Illumina).

The small insert DNA library was prepared using New England Biomedicals NEBNext reagents, and size selection (350 bp) was performed using gel extraction.

Size selection of fragments between 300 450 bp was performed using a Pippin-Prep 2% gel cassette (Sage Sciences, Beverly, MA).

The final assembly in one large contig of 15,848 bp was performed using SeqMan (DNAStar Inc., Madison, WI, USA).

Paired-end sequencing of 2×50 bp was performed using Illumina's Hiseq2000, pooling 10 samples per lane.

To determine positive samples, direct sequencing of the nested PCR product, approximately 220 base pairs (bp) was performed using the primers TGVseq – IYGseq.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: